Top » Catalog » SNPs » FGC4451

$18.00

FGC4451
[FGC4451]

FGC4451
hg38 Position: ChrY:9310745..9310745
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC4453
Forward Primer: FGC4451_F GCTACAGGTGAATGAAAACACAAC
Reverse Primer: FGC4451_R AAAAATTGAAATGTTATTTCTGCTGC
Reviews

Customers who bought this product also purchased
FGC4371
FGC4371
FGC1721
FGC1721
PH1603
PH1603
FGC7
FGC7
FGC1696
FGC1696
BY2
BY2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies