Top » Catalog » SNPs » FGC4465

$18.00

FGC4465
[FGC4465]

FGC4465
hg38 Position: ChrY:21312371..21312371
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4465_F GAAGATATCAAAATTTCTTAATTTTGTTTACTTC
Reverse Primer: FGC4465_R CGATGTGCAAATCATGCC
Reviews

Customers who bought this product also purchased
FGC1696
FGC1696
FGC10591
FGC10591
ZS4691
ZS4691
FGC1707
FGC1707
FGC1721
FGC1721
ZS9061
ZS9061
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies