Top » Catalog » SNPs » FGC4465

$18.00

FGC4465
[FGC4465]

FGC4465
hg38 Position: ChrY:21312371..21312371
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4465_F GAAGATATCAAAATTTCTTAATTTTGTTTACTTC
Reverse Primer: FGC4465_R CGATGTGCAAATCATGCC
Reviews

Customers who bought this product also purchased
Y80610
Y80610
PH1603
PH1603
FGC4453
FGC4453
BY72787
BY72787
FGC41723
FGC41723
FGC1696
FGC1696
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies