Top » Catalog » SNPs » FGC4465

$18.00

FGC4465
[FGC4465]

FGC4465
hg38 Position: ChrY:21312371..21312371
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4465_F GAAGATATCAAAATTTCTTAATTTTGTTTACTTC
Reverse Primer: FGC4465_R CGATGTGCAAATCATGCC
Reviews

Customers who bought this product also purchased
FGC1707
FGC1707
FGC1721
FGC1721
ZS9061
ZS9061
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC8812
FGC8812
ZS8188
ZS8188
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies