Top » Catalog » SNPs » FGC15177

$18.00

FGC15177
[FGC15177]

FGC15177
hg38 Position: ChrY:8340997..8340997
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC15177_F AACGGTGTCACTCTCAAATCC
Reverse Primer: FGC15177_R TTGGCAGCGTCTAGAATAGG
Reviews

Customers who bought this product also purchased
FGC7
FGC7
L1303
L1303
FGC1713
FGC1713
BY2
BY2
BY3
BY3
FGC5
FGC5
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies