Top » Catalog » Y SNPs » Z20777

$18.00

Z20777
[Z20777]

Z20777
hg38 Position: ChrY:20632928..20632928
Ancestral: G
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC7; Found in Big Y samples 181957 338570 188717
Forward Primer: Z20777_F TCCCTTTGTTTGCTCCAGAC
Reverse Primer: Z20777_R GGTAGAGCATCAGGCAGGTG
Reviews

Customers who bought this product also purchased
M96
M96
FGC4314
FGC4314
BY37630
BY37630
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
ZS4753
ZS4753
BY37632
BY37632
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies