Top » Catalog » SNPs » ZS9251

$18.00

ZS9251
[ZS9251]

ZS9251
hg38 Position: ChrY:15083987..15083987
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1715
Forward Primer: ZS9251_F GGATTGCTTCCAGACATGTG
Reverse Primer: ZS9251_R AGGCCTGGAAAAGTGAATTATG
Reviews

Customers who bought this product also purchased
DYS391
DYS391
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies