Top » Catalog » SNPs » ZS9251

$18.00

ZS9251
[ZS9251]

ZS9251
hg38 Position: ChrY:15083987..15083987
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1715
Forward Primer: ZS9251_F GGATTGCTTCCAGACATGTG
Reverse Primer: ZS9251_R AGGCCTGGAAAAGTGAATTATG
Reviews

Customers who bought this product also purchased
DYS391
DYS391
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies