Top » Catalog » SNPs » ZS8311

$18.00

ZS8311
[ZS8311]

ZS8311
hg38 Position: ChrY:12202204..12202204
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC1713
Forward Primer: ZS8311_F CACTTTCTGTTTACCCCTGTAAAGAG
Reverse Primer: ZS8311_R CTTCAAGGTGATGGTGTTATGAC
Reviews

Customers who bought this product also purchased
M267
M267
M9
M9
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
FGC40709
FGC40709
FGC1695
FGC1695
HU170
HU170
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies