Top » Catalog » SNPs » ZS8311

$18.00

ZS8311
[ZS8311]

ZS8311
hg38 Position: ChrY:12202204..12202204
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC1713
Forward Primer: ZS8311_F CACTTTCTGTTTACCCCTGTAAAGAG
Reverse Primer: ZS8311_R CTTCAAGGTGATGGTGTTATGAC
Reviews

Customers who bought this product also purchased
M96
M96
FGC4453
FGC4453
FGC1696
FGC1696
ZS9588
ZS9588
M168
M168
ZS7288
ZS7288
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies