Top » Catalog » SNPs » ZS8311

$18.00

ZS8311
[ZS8311]

ZS8311
hg38 Position: ChrY:12202204..12202204
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC1713
Forward Primer: ZS8311_F CACTTTCTGTTTACCCCTGTAAAGAG
Reverse Primer: ZS8311_R CTTCAAGGTGATGGTGTTATGAC
Reviews

Customers who bought this product also purchased
ZS7282
ZS7282
FT77163
FT77163
ZS5804
ZS5804
FGC1729
FGC1729
FGC1703
FGC1703
ZS4717
ZS4717
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies