Top » Catalog » SNPs » ZS8311

$18.00

ZS8311
[ZS8311]

ZS8311
hg38 Position: ChrY:12202204..12202204
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC1713
Forward Primer: ZS8311_F CACTTTCTGTTTACCCCTGTAAAGAG
Reverse Primer: ZS8311_R CTTCAAGGTGATGGTGTTATGAC
Reviews

Customers who bought this product also purchased
FGC65856
FGC65856
ALK443
ALK443
FGC60163
FGC60163
FGC60167
FGC60167
FGC65873
FGC65873
ZS8379
ZS8379
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies