Top » Catalog » SNPs » ZS8311

$18.00

ZS8311
[ZS8311]

ZS8311
hg38 Position: ChrY:12202204..12202204
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC1713
Forward Primer: ZS8311_F CACTTTCTGTTTACCCCTGTAAAGAG
Reverse Primer: ZS8311_R CTTCAAGGTGATGGTGTTATGAC
Reviews

Customers who bought this product also purchased
FGC1713
FGC1713
ZS7295
ZS7295
FGC1707
FGC1707
ZS7213
ZS7213
FGC5
FGC5
FGC1715
FGC1715
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies