Top » Catalog » SNPs » Y3183

$18.00

Y3183
[Y3183]

Y3183
hg38 Position: ChrY:7164713..7164713
Ancestral: C
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13 > Z5018 > Z16659
Forward Primer: Y3183_F GCTACATTATGTTACAGCCTTGAGTTAG
Reverse Primer: Y3183_R TTCATCACATTCCCTTGACAAG
Reviews

Customers who bought this product also purchased
Z834
Z834
BY5350
BY5350
BY5431
BY5431
Z16242
Z16242
V12
V12
BY5355
BY5355
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies