Top » Catalog » SNPs » CTS6080

$18.00

CTS6080
[CTS6080]

CTS6080
hg38 Position: ChrY:14544237..14544237
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b (not listed)
Comments: Syn. with CTS11457; downstream V22
Forward Primer: CTS6080_F TCCTCTTTACCAACCCACAGTTAG
Reverse Primer: CTS6080_R CTATGACTGACGGTATCCAGTATGAC
Reviews

Customers who bought this product also purchased
CTS567
CTS567
FGC92599
FGC92599
M267
M267
Y133046
Y133046
BY7446
BY7446
Y20406
Y20406
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies