Top » Catalog » SNPs » CTS6080

$18.00

CTS6080
[CTS6080]

CTS6080
hg38 Position: ChrY:14544237..14544237
Ancestral: A
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b (not listed)
Comments: Syn. with CTS11457; downstream V22
Forward Primer: CTS6080_F TCCTCTTTACCAACCCACAGTTAG
Reverse Primer: CTS6080_R CTATGACTGACGGTATCCAGTATGAC
Reviews

Customers who bought this product also purchased
Y16563
Y16563
FGC2739
FGC2739
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
FGC62866
FGC62866
V22
V22
CTS9334
CTS9334
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies