Top » Catalog » SNPs » PH2818

$18.00

PH2818
[PH2818]

PH2818
hg38 Position: ChrY:14970180..14970180
Ancestral: G
Derived: A
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: E1b1
Comments: Below V22 > CTS6080
Forward Primer: PH2818_F AACTTGAATTTGCTTTCTAATTTCTCC
Reverse Primer: PH2818_R GAGCTTTATGTGTGTATTTTGTTTAGTTG
Reviews

Customers who bought this product also purchased
Z1902
Z1902
Z5017
Z5017
Z1057
Z1057
V22
V22
E1b-V13 Panel
E1b-V13 Panel
BY10366
BY10366
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies