Top » Catalog » SNPs » PH2818

$18.00

PH2818
[PH2818]

PH2818
hg38 Position: ChrY:14970180..14970180
Ancestral: G
Derived: A
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: E1b1
Comments: Below V22 > CTS6080
Forward Primer: PH2818_F AACTTGAATTTGCTTTCTAATTTCTCC
Reverse Primer: PH2818_R GAGCTTTATGTGTGTATTTTGTTTAGTTG
Reviews

Customers who bought this product also purchased
CTS5856
CTS5856
Z827
Z827
L674
L674
S3003
S3003
M35
M35
Y16563
Y16563
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies