Top » Catalog » SNPs » PH2818

$18.00

PH2818
[PH2818]

PH2818
hg38 Position: ChrY:14970180..14970180
Ancestral: G
Derived: A
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: E1b1
Comments: Below V22 > CTS6080
Forward Primer: PH2818_F AACTTGAATTTGCTTTCTAATTTCTCC
Reverse Primer: PH2818_R GAGCTTTATGTGTGTATTTTGTTTAGTTG
Reviews

Customers who bought this product also purchased
CTS567
CTS567
BY7446
BY7446
Z834
Z834
M267
M267
FGC2739
FGC2739
M96
M96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies