Top » Catalog » SNPs » ZS6421

$18.00

ZS6421
[ZS6421]

ZS6421
hg38 Position: ChrY:13044599..13044599
Ancestral: A
Derived: C
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: downstream FGC1703
Forward Primer: ZS6421_F GACCAAAAAGCCAATACAAAGG
Reverse Primer: ZS6421_R TCCCTTTAGTTTTTGGGAATAGC
Reviews

Customers who bought this product also purchased
FGC5
FGC5
ZS4717
ZS4717
FGC1707
FGC1707
FGC1703
FGC1703
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC1715
FGC1715
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies