Top » Catalog » SNPs » ZS6421

$18.00

ZS6421
[ZS6421]

ZS6421
hg38 Position: ChrY:13044599..13044599
Ancestral: A
Derived: C
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: downstream FGC1703
Forward Primer: ZS6421_F GACCAAAAAGCCAATACAAAGG
Reverse Primer: ZS6421_R TCCCTTTAGTTTTTGGGAATAGC
Reviews

Customers who bought this product also purchased
FGC1713
FGC1713
FGC1729
FGC1729
FGC5
FGC5
ZS4717
ZS4717
FGC1707
FGC1707
FGC1703
FGC1703
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies