Top » Catalog » SNPs » FGC1729

$18.00

FGC1729
[FGC1729]

FGC1729
hg38 Position: ChrY:20360318..20360318
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC1729_F CATGCCTCTCTTTCCTGTCC
Reverse Primer: FGC1729_R AATGCTGACAAGATCTGAAAAATG
Reviews

Customers who bought this product also purchased
FGC1713
FGC1713
FGC38706
FGC38706
FGC5
FGC5
ZS4717
ZS4717
FGC1707
FGC1707
FGC1703
FGC1703
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies