Top » Catalog » SNPs » FGC1729

$18.00

FGC1729
[FGC1729]

FGC1729
hg38 Position: ChrY:20360318..20360318
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC1729_F CATGCCTCTCTTTCCTGTCC
Reverse Primer: FGC1729_R AATGCTGACAAGATCTGAAAAATG
Reviews

Customers who bought this product also purchased
FGC1703
FGC1703
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC1715
FGC1715
ZS5809
ZS5809
ZS6421
ZS6421
FGC1713
FGC1713
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies