Top » Catalog » SNPs » Y15543

$18.00

Y15543
[Y15543]

Y15543
hg38 Position: ChrY:10625292..10625292
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: Y15543_F ACAAAAAGAGTGTTTCAAAACTACTCAG
Reverse Primer: Y15543_R GGAAATATCTTCACACAAACAGGAC
Reviews

Customers who bought this product also purchased
Y16809
Y16809
Z58
Z58
Z2337
Z2337
FGC29197
FGC29197
mtComplete
mtComplete
S4767
S4767
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies