Top » Catalog » SNPs » ZS11430

$18.00

ZS11430
[ZS11430]

ZS11430
HG19 Position: ChrY:16000399..16000399
Ancestral: C
Derived: T
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream ZS5010
Forward Primer: ZS11430_F CATAAAATAAAATCTTTCTCCCTCTCTG
Reverse Primer: ZS11430_R GTACTTACAGGATATTATGAAACTGGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies