Top » Catalog » SNPs » FGC32664

$18.00

FGC32664
[FGC32664]

FGC32664
hg38 Position: ChrY:26503148..26503148
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: Below L513 > S5979 > A5
Forward Primer: FGC32664_F ACTCCCATTCTCATTTCATATTTCC
Reverse Primer: FGC32664_R GCAGTTCTCAGAACCTGTTCTGA
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies