Top » Catalog » SNPs » FGC4469

$19.00

FGC4469
[FGC4469]

FGC4469
hg38 Position: ChrY:2996039..2996039
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4469_F TAACTTTCTGGACGGGGTTG
Reverse Primer: FGC4469_R AACCAGAAATAAGAGGGGACATTAC
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC5462
FGC5462
ZS6400
ZS6400
FGC4486
FGC4486
FGC5468
FGC5468
FGC5427
FGC5427
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies