Honichtopf
Cart Contents
Checkout
My Account
Top
»
Catalog
»
SNPs
»
FGC4469
$19.00
FGC4469
[FGC4469]
hg38 Position:
ChrY:2996039..2996039
Ancestral:
G
Derived:
A
Reference:
Full Genomes Corp (2013)
ISOGG Haplogroup:
J1
Comments:
.
Forward Primer:
FGC4469_F TAACTTTCTGGACGGGGTTG
Reverse Primer:
FGC4469_R AACCAGAAATAAGAGGGGACATTAC
Add to Cart
Reviews
Customers who bought this product also purchased
J1-M267 Superclade Panel
FGC5462
ZS6400
FGC4486
FGC5468
FGC5427
Categories
Y Haplogroup Panels
(96)
Y Custom SNP Panels
(214)
SNPs
(413753)
Y-STR Beginner Panels
(3)
Y-STR Enhanced Panels->
(6)
Y-STRs
(126)
mtDNA Beginner Tests
(3)
mtDNA Enhanced Tests->
(31)
NGS Tests->
(5)
Various
(5)
Haplogroups
Please Select
A0
A00
A1a
A1b
A1b1
B
C
D
E
G
H
I1
I2
J1
J2
L
LT
M
N
O
other
Q
R1a
R1b
R2
S
T
Quick Find
Use keywords to find the product you are looking for.
Advanced Search
Reviews
Write a review on this product!
Information
Shipping & Returns
Privacy Notice
Conditions of Use
F.A.Q.
Contact Us
Impressum
Currencies
U.S. Dollar
Euro