Top » Catalog » SNPs » FGC4469

$18.00

FGC4469
[FGC4469]

FGC4469
hg38 Position: ChrY:2996039..2996039
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4469_F TAACTTTCTGGACGGGGTTG
Reverse Primer: FGC4469_R AACCAGAAATAAGAGGGGACATTAC
Reviews

Customers who bought this product also purchased
ZS6400
ZS6400
FGC4486
FGC4486
FGC5468
FGC5468
FGC5427
FGC5427
ZS3873
ZS3873
FGC2
FGC2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies