Top » Catalog » SNPs » FGC4487

$18.00

FGC4487
[FGC4487]

FGC4487
hg38 Position: ChrY:20462870..20462870
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC4
Comments: Downstream of J1-FGC4
Forward Primer: FGC4487_F GAAGGTCCACTCCAGACCAG
Reverse Primer: FGC4487_R GACATACCAGGAGATTATATCACGC
Reviews

Customers who bought this product also purchased
BY145
BY145
ZS3911
ZS3911
FGC4474
FGC4474
ZS5631
ZS5631
FGC1696
FGC1696
ZS3912
ZS3912
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies