Top » Catalog » SNPs » FGC4487

$18.00

FGC4487
[FGC4487]

FGC4487
hg38 Position: ChrY:20462870..20462870
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC4
Comments: Downstream of J1-FGC4
Forward Primer: FGC4487_F GAAGGTCCACTCCAGACCAG
Reverse Primer: FGC4487_R GACATACCAGGAGATTATATCACGC
Reviews

Customers who bought this product also purchased
FGC2
FGC2
ZS3873
ZS3873
FGC5
FGC5
ZS3961
ZS3961
ZS6589
ZS6589
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies