Top » Catalog » SNPs » FGC4494

$19.00

FGC4494
[FGC4494]

FGC4494
hg38 Position: ChrY:20931757..20931757
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4494_F AAAACATCATAATGACAGAATCGAAC
Reverse Primer: FGC4494_R CTTTATGAATCTGGGTTCTCCAC
Reviews

Customers who bought this product also purchased
FGC6770
FGC6770
FT375962
FT375962
ZS12043
ZS12043
FT148004
FT148004
ZS7093
ZS7093
A27207
A27207
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies