Top » Catalog » SNPs » FGC4494

$19.00

FGC4494
[FGC4494]

FGC4494
hg38 Position: ChrY:20931757..20931757
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4494_F AAAACATCATAATGACAGAATCGAAC
Reverse Primer: FGC4494_R CTTTATGAATCTGGGTTCTCCAC
Reviews

Customers who bought this product also purchased
FGC67924
FGC67924
A338
A338
FT126929
FT126929
ALK397
ALK397
FGC6770
FGC6770
FT375962
FT375962
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies