Top » Catalog » SNPs » FGC4494

$19.00

FGC4494
[FGC4494]

FGC4494
hg38 Position: ChrY:20931757..20931757
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4494_F AAAACATCATAATGACAGAATCGAAC
Reverse Primer: FGC4494_R CTTTATGAATCTGGGTTCTCCAC
Reviews

Customers who bought this product also purchased
Y14193
Y14193
FT288437
FT288437
BY136374
BY136374
Y337745
Y337745
A30104
A30104
ZS9240
ZS9240
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies