Top » Catalog » SNPs » FGC5462

$18.00

FGC5462
[FGC5462]

FGC5462
hg38 Position: ChrY:8049521..8049521
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5462_F GAACATTTGTGTTTGTTCCAAGC
Reverse Primer: FGC5462_R GGATCTAATTAGACTAATGAGTTTTTGTG
Reviews

Customers who bought this product also purchased
ZS6589
ZS6589
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS3961
ZS3961
FGC4469
FGC4469
FGC4486
FGC4486
ZS6400
ZS6400
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies