Top » Catalog » SNPs » FGC5468

$18.00

FGC5468
[FGC5468]

FGC5468
hg38 Position: ChrY:22294351..22294351
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5468_F GGAGAAATATAATCTAATCTAGCTCTCTAAACC
Reverse Primer: FGC5468_R CAGAGAAACATGCCCTACAACTTC
Reviews

Customers who bought this product also purchased
ZS3961
ZS3961
ZS6589
ZS6589
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC5462
FGC5462
FGC4469
FGC4469
FGC4486
FGC4486
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies