Top » Catalog » SNPs » ZS10289

$18.00

ZS10289
[ZS10289]

ZS10289
hg38 Position: ChrY:8302595..8302595
Ancestral: G
Derived: A
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC5422
Forward Primer: ZS10289_F GGGATGCGGAGATTGTAGTG
Reverse Primer: ZS10289_R AGAAATTTTAATTCCTTGAAAGACCC
Reviews

Customers who bought this product also purchased
FGC5424
FGC5424
Z18219
Z18219
Y22049
Y22049
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Z18220
Z18220
ZS6416
ZS6416
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies