Top » Catalog » SNPs » ZS3911

$18.00

ZS3911
[ZS3911]

ZS3911
hg38 Position: ChrY:16278822..16278822
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC4474. Found in Big Y sample M8135
Forward Primer: ZS3911_F TGCTCAAATGCAAAATGAATG
Reverse Primer: ZS3911_R AAGAATGGAAGGAGGGAGTG
Reviews

Customers who bought this product also purchased
FGC2
FGC2
FGC4487
FGC4487
ZS5630
ZS5630
FGC5
FGC5
ZS7093
ZS7093
ZS5626
ZS5626
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies