Top » Catalog » SNPs » ZS3911

$18.00

ZS3911
[ZS3911]

ZS3911
hg38 Position: ChrY:16278822..16278822
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC4474. Found in Big Y sample M8135
Forward Primer: ZS3911_F TGCTCAAATGCAAAATGAATG
Reverse Primer: ZS3911_R AAGAATGGAAGGAGGGAGTG
Reviews

Customers who bought this product also purchased
FGC1696
FGC1696
BY145
BY145
ZS5631
ZS5631
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC4474
FGC4474
ZS3912
ZS3912
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies