Top » Catalog » SNPs » ZS3961

$18.00

ZS3961
[ZS3961]

ZS3961
hg38 Position: ChrY:8066702..8066702
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4471; Found in Big Y sample M9235
Forward Primer: ZS3961_F CTCCCTCCTTAAGCCCTACAC
Reverse Primer: ZS3961_R ACAGGCCAACCAGTAGCATC
Reviews

Customers who bought this product also purchased
FGC5
FGC5
FGC4487
FGC4487
ZS6589
ZS6589
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC5462
FGC5462
FGC4469
FGC4469
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies