Top » Catalog » SNPs » ZS3961

$18.00

ZS3961
[ZS3961]

ZS3961
hg38 Position: ChrY:8066702..8066702
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4471; Found in Big Y sample M9235
Forward Primer: ZS3961_F CTCCCTCCTTAAGCCCTACAC
Reverse Primer: ZS3961_R ACAGGCCAACCAGTAGCATC
Reviews

Customers who bought this product also purchased
ZS6400
ZS6400
FGC5427
FGC5427
FGC5468
FGC5468
FGC2
FGC2
ZS3873
ZS3873
FGC5
FGC5
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18435
1 x mtComplete
$183.00
Haplogroup Info
Other products
Currencies