Top » Catalog » SNPs » ZS5613

$18.00

ZS5613
[ZS5613]

ZS5613
hg38 Position: ChrY:8539025..8539025
Ancestral: C
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC2. Found in Big Y sample M6758
Forward Primer: ZS5613_F TCTAGCTCCTGAGAACCAGAAACTAC
Reverse Primer: ZS5613_R TCTTTGTGACCACAAGCTGTG
Reviews

Customers who bought this product also purchased
ZS12329
ZS12329
FGC4453
FGC4453
ZS7093
ZS7093
Y30093
Y30093
FGC11
FGC11
ZS7091
ZS7091
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies