Top » Catalog » SNPs » ZS5613

$18.00

ZS5613
[ZS5613]

ZS5613
hg38 Position: ChrY:8539025..8539025
Ancestral: C
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC2. Found in Big Y sample M6758
Forward Primer: ZS5613_F TCTAGCTCCTGAGAACCAGAAACTAC
Reverse Primer: ZS5613_R TCTTTGTGACCACAAGCTGTG
Reviews

Customers who bought this product also purchased
FT105587
FT105587
ZS10638
ZS10638
FGC1696
FGC1696
FT104758
FT104758
M267
M267
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies