Top » Catalog » SNPs » ZS5631

$19.00

ZS5631
[ZS5631]

ZS5631
hg38 Position: ChrY:16277046..16277046
Ancestral: T
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4474. Found in Big Y sample M4281
Forward Primer: ZS5631_F TTAACTAAAAAATTCTGCCAAGGG
Reverse Primer: ZS5631_R AAGAACAAAGGCTTCCACAGTG
Reviews

Customers who bought this product also purchased
FGC1707
FGC1707
Y12364
Y12364
PF4664
PF4664
Y12883
Y12883
FGC7393
FGC7393
FGC1
FGC1
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies