Top » Catalog » SNPs » ZS5631

$18.00

ZS5631
[ZS5631]

ZS5631
hg38 Position: ChrY:16277046..16277046
Ancestral: T
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4474. Found in Big Y sample M4281
Forward Primer: ZS5631_F TTAACTAAAAAATTCTGCCAAGGG
Reverse Primer: ZS5631_R AAGAACAAAGGCTTCCACAGTG
Reviews

Customers who bought this product also purchased
FGC4487
FGC4487
ZS5630
ZS5630
FGC5
FGC5
ZS7093
ZS7093
ZS5626
ZS5626
FGC1696
FGC1696
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies