Top » Catalog » SNPs » ZS6400

$18.00

ZS6400
[ZS6400]

ZS6400
hg38 Position: ChrY:16861477..16861477
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4474
Forward Primer: ZS6400_F TATGACCTCCCAAGCCACTG
Reverse Primer: ZS6400_R CAACGCAGACATAATAAGATGG
Reviews

Customers who bought this product also purchased
FGC5427
FGC5427
ZS3873
ZS3873
FGC2
FGC2
FGC4487
FGC4487
FGC5
FGC5
ZS3961
ZS3961
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies