Top » Catalog » SNPs » ZS6400

$18.00

ZS6400
[ZS6400]

ZS6400
hg38 Position: ChrY:16861477..16861477
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4474
Forward Primer: ZS6400_F TATGACCTCCCAAGCCACTG
Reverse Primer: ZS6400_R CAACGCAGACATAATAAGATGG
Reviews

Customers who bought this product also purchased
FGC4487
FGC4487
FGC5
FGC5
ZS3961
ZS3961
ZS6589
ZS6589
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC5462
FGC5462
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies