Top » Catalog » SNPs » ZS7094

$18.00

ZS7094
[ZS7094]

ZS7094
hg38 Position: ChrY:12282822..12282822
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Corrected by submitter. Previously ChrY:22633320 T to C. Now: downstream FGC2
Forward Primer: ZS7094_F GGTTTTAGAGGTGGGTAATAGAGTCTG
Reverse Primer: ZS7094_R ATATTCCCCCACTAAAAAGAAAGC
Reviews

Customers who bought this product also purchased
FGC6770
FGC6770
BY145
BY145
FGC4486
FGC4486
FGC11
FGC11
ZS12046
ZS12046
DYS390
DYS390
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies