Top » Catalog » SNPs » ZS7094

$18.00

ZS7094
[ZS7094]

ZS7094
HG19 Position: ChrY:14403525..14403525
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Corrected by submitter. Previously ChrY:22633320 T to C. Now: downstream FGC5
Forward Primer: ZS7094_F GGTTTTAGAGGTGGGTAATAGAGTCTG
Reverse Primer: ZS7094_R ATATTCCCCCACTAAAAAGAAAGC
Reviews

Customers who bought this product also purchased
DYS607
DYS607
CDY
CDY
DYS390
DYS390
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
ZS9542
ZS9542
FGC7
FGC7
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies