Top » Catalog » SNPs » ZS7095

$18.00

ZS7095
[ZS7095]

ZS7095
hg38 Position: ChrY:13016950..13016950
Ancestral: C
Derived: T
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Corrected by submitter. Previously ChrY:23123857 C to T. Now: downstream FGC5
Forward Primer: ZS7095_F AGGGCATTTCCCAGGTTATC
Reverse Primer: ZS7095_R AGAACCACAAAGCAGAACTGG
Reviews

Customers who bought this product also purchased
FGC1713
FGC1713
FGC11
FGC11
P58
P58
Y36224
Y36224
ZS7531
ZS7531
ZS7093
ZS7093
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies