Top » Catalog » SNPs » ZS7528

$18.00

ZS7528
[ZS7528]

ZS7528
hg38 Position: ChrY:8112070..8112070
Ancestral: A
Derived: G
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC2. Found in Big Y sample M9881
Forward Primer: ZS7528_F AGGGATGGAAATATTTGCTATTATTC
Reverse Primer: ZS7528_R TAAAAGGACTGCGATGGTCAG
Reviews

Customers who bought this product also purchased
ZS7093
ZS7093
BY145
BY145
FGC1713
FGC1713
ZS7531
ZS7531
PF5197
PF5197
Y7708
Y7708
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies