Top » Catalog » SNPs » ZS7528

$18.00

ZS7528
[ZS7528]

ZS7528
hg38 Position: ChrY:8112070..8112070
Ancestral: A
Derived: G
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream FGC2. Found in Big Y sample M9881
Forward Primer: ZS7528_F AGGGATGGAAATATTTGCTATTATTC
Reverse Primer: ZS7528_R TAAAAGGACTGCGATGGTCAG
Reviews

Customers who bought this product also purchased
Y36224
Y36224
ZS7539
ZS7539
ZS7530
ZS7530
FGC85618
FGC85618
FGC1713
FGC1713
ZS7531
ZS7531
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies