Top » Catalog » SNPs » ZS8321

$18.00

ZS8321
[ZS8321]

ZS8321
hg38 Position: ChrY:2896690..2896690
Ancestral: T
Derived: C
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC2
Forward Primer: ZS8321_F TGTGAGCACAAGGACTTACAGAC
Reverse Primer: ZS8321_R GAAACCAGCCAATAAAGAGCAC
Reviews

Customers who bought this product also purchased
ZS8988
ZS8988
FGC45019
FGC45019
FGC60202
FGC60202
ZS10638
ZS10638
FGC1696
FGC1696
FT104758
FT104758
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies