Top » Catalog » SNPs » ZS8321

$18.00

ZS8321
[ZS8321]

ZS8321
hg38 Position: ChrY:2896690..2896690
Ancestral: T
Derived: C
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC2
Forward Primer: ZS8321_F TGTGAGCACAAGGACTTACAGAC
Reverse Primer: ZS8321_R GAAACCAGCCAATAAAGAGCAC
Reviews

Customers who bought this product also purchased
ZS10638
ZS10638
FGC1696
FGC1696
FT104758
FT104758
FT105587
FT105587
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
ZS10640
ZS10640
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies