Top » Catalog » SNPs » ZS8321

$18.00

ZS8321
[ZS8321]

ZS8321
hg38 Position: ChrY:2896690..2896690
Ancestral: T
Derived: C
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC2
Forward Primer: ZS8321_F TGTGAGCACAAGGACTTACAGAC
Reverse Primer: ZS8321_R GAAACCAGCCAATAAAGAGCAC
Reviews

Customers who bought this product also purchased
Y22089
Y22089
FGC4453
FGC4453
ZS7093
ZS7093
Y30093
Y30093
FGC11
FGC11
ZS12046
ZS12046
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies